|
Bands of Cypher Game II: Secrets of the ELE Puzzle
The story behind the second Portal is that it can tune into the locations of the protected tribes of the Yumi with the help of the Guardian Tribes.
A Yumi understands the universal language of genetics and telepathically communicates with members of the tribes that it is genetically linked to.
To open the second portal, DNA samples of the Guardian Tribe are needed to form a secret message that is broadcasted to the Nether world.
Once the correct message is built from the DNA of the Guardian Yumies the portal will open and a member of the hidden Protected Tribe (ELE) may respond to our call.
Puzzle Objective (Locked Stage)
The Game Portal II is locked until you have increased its Nether Power to 100%.
To UNLOCK the Portal you need Guardian Yumies and one Keeper of any level.
- TIP: The higher the hierarchy of the Guardian Yumi, the more Nether power it gives to the portal.
- Guardian Yumies' Hierarchy (lowest to highest): Abundant -> Uncommon -> Rare -> Legendary -> Mythical -> Artifacted
- TIP: Keepers can be either discovered from Game Portal I or purchased with your Cypher Reward Tokens.
The higher the Keeper Level, the higher your Portal's "level", the more hierarchies you can find for that Portal.
Unlocking Portal II Puzzle
\o/ I have my Yumies and Keeper - I am ready to UNLOCK this portal! \o/
- Rez a Guardian Yumi next to the portal.
- Click the Portal and choose "Transcode"
- Long-click (click and hold) on the Yumi and choose "Transcode".
- CONTINUE Steps 2 and 3 until the Portal's Nether is at 100%
- Rez your Keeper next to the portal.
- Click the Portal and choose "Transcode"
- Long-click (click and hold) on the Keeper and choose "Transcode".
\o/ The Portal is now unlocked! \o/
IMPORTANT TIP: Once a Keeper has been Transcoded to the Portal, the Keeper Level of the portal CANNOT be changed.
Transcode your highest level Keeper you wish to use for that Portal's lifespan.
Puzzle Objective (Scanner HUD Stage)
The Cypher Scanner HUD is used to scan DNA samples of Yumies and Yumi crystals. Then you need to find/splice
the useful Cypher CODONS until your progress bar on the HUD is at 100%.
In order to play the puzzle, you must first scan 5 unique Yumies and/or Yumi Crystals.
Solving Cypher Scanner HUD Puzzle

- Click the SCAN (magnifying glass) icon to scan DNAs of Yumies and Yumi Crystals (within 15 meters of you).
Once you have 50 samples of DNA collected, you can begin the splicing process.
- A long strand of DNA (example: ACTGGAGTAGCGGTCTATTC) will show up on the HUD. In each strand, you need to find AS MANY combinations of "useful" Cypher Codons:
- TIP: Memorize these useful codons for best puzzle performance.
- AAA (Fire)
- TTT (Water)
- CCC (Nature)
- GGG (Earth)
- ATC (Metal)
- TCG (Nether)
- ATG (Energy)
- TAG (Amber)
- Click at a location on the strand where you see the above mentioned codons. You must click the first Letter in the set of 3 letters for codon to register.

- Once you click, you will see that the strand gets "shorter" and shifts around to accommodate for the splice.
You can splice ANY codon (set of 3 letters) like GAT or ATA etc, but ONLY the above mentioned "useful codons" count towards your SCORE.
- HIDDEN CODONS:
- Sometimes useful CODONS can be "HIDDEN" in the middle of non-useful codons or other codons.
This means that you may need to shuffle some codons around in order to reach a codon.

Once the above splice is made the strand will "shift" and become shorter to:

\o/ Cypher Scanner HUD reached 100% progress! (But I have more DNA strands remaining?) \o/
NOW You have 2 Choices:
CHOICE #1: Send your Top Score to the Portal. (Follow the steps in the "Sending Puzzle Score to Portal II" section below)
CHOICE #2: Continue finding the CODONS in the rest of the DNA strands. This will result in possibly beating your current Top Score, but may take a little longer.
- TIP: Higher scores can result in better Affinity** trait of the Yumi and higher the chance of a Yumi response from the Portal.
** Affinity is how long a Yumi remains attuned to the Nether. A Yumi with a stronger Affinity can Transcode more times than a Yumi with weaker Affinity.
Scoring, Streak, Bonus Box and Jackpots
- With each codon found, your SCORE increases. If you find MORE than 1 codon in a strand, you gain a STREAK bonus. The longer your streak, the higher your score.
- Finding 3 or more codons in a single strand (streak of 3) will give you a bonus towards a JACKPOT. You will see the number show up in the JACKPOT on the HUD.
- Finding 3 or more codons in 3 consecutive strands (your JACKPOT will show all 3 numbers) will give you a JACKPOT bonus, which includes BONUS codons and a SCORE BONUS from
automatic streak carry over into the next strand (one number from your JACKPOT will show up when you progress to the next strand).
There are four JACKPOTS in the game:
- JACKPOT 333
- JACKPOT 444
- JACKPOT 555
- JACKPOT 666 (denoted by ***)
GAME TIPS:
- The MORE useful codons you find in each strand, the HIGHER your score will be.
- Score affects Affinity** trait of the Yumi and the chance of a Yumi response from the Portal.
- The more JACKPOTS you get the faster you will progress through the puzzle and the higher your chance to gain BONUS CHARGES on your Portal.
Sending Puzzle Score to Portal II
NOTE: Your Cypher Scanner HUD must be at 100% progress in order to complete these steps:
- Click the Game Portal II and choose "AddCypher".
- Click "Send2Portal" icon on the Cypher Scanner HUD.
- The Portal will confirm that it has received the codons and score. Once the results are transferred, an ELE Yumi may appear.
|